amandavelez12122005 amandavelez12122005

01-02-2019
Mathematics

contestada

Shirley spelled 12 of her 15 spelling words correctly on the test. What percentage did Shirley get on the test?

Respuesta :

puppylove899 puppylove899

01-02-2019

Answer: the answer should be 80%

hope this helps

Answer Link

sarinawhitaker sarinawhitaker

01-02-2019

Answer:

I'm pretty sure its 70%

Step-by-step explanation:

because if she got 12 out of 15 then she got three wrong so that would mean she has 70% not 80% sorry to confuse you

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w

which is a reason that protists are difficult to classify

What is the difference in elevation between a plane flying at 25,500 ft above sea level and a submarine traveling 450 ft below sea level?

Your religious identity is only important for you within your family and does not matter in the public sphere.

Solve the system algebraically. check your work. 2x + 5y = 10 2x + 3y = 6

Which country is the world’s largest producer of wheat? USA China Russia France

Mi abuelo no es joven. Es _____

what is x? using the picture below and directions

PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a