brattynev2019 brattynev2019

04-06-2019
English

contestada

Identify the sentence that uses the verb mood in the imperative.

Identify the sentence that uses the verb mood in the imperative class=

Respuesta :

04-06-2019

Answer:

a

Explanation:

Answer Link

Otras preguntas

Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)

what is the difference in length between a 1 and 1/4 inch button and a 3/8 inch button

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

When a circular pizza is cut into six slices using diameters, the total length of the cuts is 18 cm. what is the area of the pizza in square centimeters?

The _______ was Franklin Roosevelt's program designed to fight the Great Depression

As the mother of a late-maturing boy, betty is concerned because, when compared to early-maturing boys, late maturers are more likely to ________.

Which is a responsibility of congress? a. determine the constitutionality of laws. b. provide budgets and fund government operations. c. select a new

Paul has grades of 86 and 85 on his first two tests. what must he score on his third test in order to have an average of at least 90

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses

How did the Bataan Death March gets its name