guitarsharkdude guitarsharkdude

04-04-2020
Mathematics

contestada

find the cube roots of -8. Write the answer in a+bi form

Respuesta :

igoroleshko156 igoroleshko156

04-04-2020

Answer:

[tex]-2 + 0i[/tex]

Step-by-step explanation:

Step 1: Find the answer

[tex]\sqrt[3]{-8}[/tex]

[tex]\sqrt[3]{(-2)^3}[/tex]

[tex]-2[/tex]

[tex]-2 + 0i[/tex]

Answer: [tex]-2 + 0i[/tex]

Answer Link

morenom2021 morenom2021

05-11-2020

Answer:

The answer is C

Step-by-step explanation:

Got a 100% on Edge 2020. The person above me is incorrect.

Answer Link

Otras preguntas

which combination of quarks produces a neutral baryon

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If abcd is a trapezoid with bases ab and dc. if ab=20, bc = 30, cd = 48, and ad =26, find the height of the trapezoid

Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in

What are the points of discontinuity? Are they all removable? Please show your work.

A child finds 30 nickels and dimes between sofa cushions. how many dimes did the child find if the total value of the coins is $1.90?

Given that A=xy find the percentage increase in A when both X and Y increase by 10%

What is the distance between points (21, -32) and (-3, -25)?

What are two concepts of government democracy?

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.