palacioshenry340 palacioshenry340
  • 03-06-2020
  • Mathematics
contestada

Find the length of DE

Find the length of DE class=

Respuesta :

maddiesherrit23 maddiesherrit23
  • 03-06-2020

Answer:20

Step-by-step explanation:

Answer Link

Otras preguntas

what is the sum of odd positive integers less than 50
Question 16 (5 points)   How are the two angles related? Question 16 options: adjacent complementary supplementary vertical
Which quotation from the text best supports the inference that the people of the sac nation do not typically challenge authority? "if he declared war he must le
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.
Which option would best fit in this diagram in the bubble labeled 1?
These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and
Which Romantic poet said, “I think I shall be among the English Poets after my death,” before dying of tuberculosis at 25? A. Lord Byron B. Samuel Coleridge
show work and factor ?
A rectangular garden hasblengtg and width as given by thr expression below length 4-7(3x+4y) eifth 3x(-2y) write a simplifird expression for the perimeter of th