bubblebob36 bubblebob36

02-07-2020
Mathematics

contestada

Classify the following triangle as acute, obtuse, or right.
80°
A. Obtuse
B. Acute
C. Right
D. None of these

Classify the following triangle as acute obtuse or right80A ObtuseB AcuteC RightD None of these class=

Respuesta :

akinterinwasarah9 akinterinwasarah9

02-07-2020

Answer: I'm guessing it's acute

Step-by-step explanation:

Since all the angles are less that 90 degrees, it can't be right or obtuse. I'm gonna say acute

Answer Link

beautywithkarenn beautywithkarenn

02-07-2020

the answer is b. acute

Answer Link

Otras preguntas

A map has a scale of 6 in : 26 mi. If Clayton and Clinton are 52 mi apart, then they are how far apart on the map?

Find the length of the missing side of a right triangle if a=6 and c=11

Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How was fidel castro able to maintain cuba's independence as a communist state while only being 90 miles off the coast of the united states?

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

Cell respiration why does a runner breathe hard after finishing a race

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors

Which great society program was a comprehensive health insurance program for all senior citizens?

Why is it important for scientists to use blind tests?