hkeira553 hkeira553
  • 05-08-2020
  • Physics
contestada

2 Which invention was crucial to the development of cell theory?

Respuesta :

1073862
1073862 1073862
  • 05-08-2020

Answer:

I guess i would say the microscope

Explanation:

Because of the microscope, we can see the cells.

Answer Link

Otras preguntas

Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
Which statement accurately describes the significance of the Magna Carta? A. It gave absolute power to the English king over the church and nobility. B.
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 examples of ionic compound?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?