Seudónimo Seudónimo
  • 02-10-2020
  • Arts
contestada

HELP ME PLZ!!!!!!!!!!!!!!!!!!

HELP ME PLZ class=

Respuesta :

britanyjannet
britanyjannet britanyjannet
  • 02-10-2020

Answer:

possibly the first one

Explanation:

Answer Link
Аноним Аноним
  • 02-10-2020

Answer: (a)

Explanation: The gate has been restored since discovering so (b) is out of the question, and (c) could be a possibility but it is not the best because the market had nothing to really do with the gate, so (a) would make the most sense considering they worshiped god(s) and their king

Answer Link

Otras preguntas

lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Please help me with this two step math problem! THANK YOU !!!!!!!!
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
i need help with this question
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
when Jefferson took office he did what
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.