paigerpreana paigerpreana
  • 01-11-2016
  • Chemistry
contestada

What are valence electrons and why are they important?

Respuesta :

syed514
syed514 syed514
  • 02-11-2016
Outermost electrons are called as valence electrons. When atom form bond with other atom , they are the first to interact with that atom .
Moreover, It also determines the octet of an atom.
Answer Link

Otras preguntas

What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what rule does static electricity follow
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
Help pl0x, Algebra 1
I want to work with LDAP. what is LDAP?
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want