etmeyer07 etmeyer07

03-02-2021
Mathematics

contestada

Write the fraction or mixed number as a percent. 1 1/4

Respuesta :

ilt9520 ilt9520

03-02-2021

Answer:

125%

Step-by-step explanation:

Answer Link

Otras preguntas

what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15

Groups that are more formal and require less continuous interaction are known as what type of group?

what is the scale factor of a cube with a volume of 343 m^3 to a cube with a volume of 5'832 m^3?

3m2+7=55 answer please

How many neutrons does element X have if its atomic number is 31 and its mass number is 90?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

We had lunch: sandwiches, potato chips, and iced tea. Carolyn and her mother talked mostly about neighbors and the congregation at the Japanese Methodist Church

Cell respiration why does a runner breathe hard after finishing a race

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

With the two endpoints of a diamter how many right triangles can be formed