faidae faidae
  • 03-02-2021
  • Mathematics
contestada

What is the area of the triangle? 2 , 2 units 2

Respuesta :

taylaann09
taylaann09 taylaann09
  • 03-02-2021

Answer:

no idea mate

Step-by-step explanation:

Answer Link

Otras preguntas

As predictors become more highly correlated, I. the p-values of the beta estimates become smaller II. it becomes more difficult to determine which predictor is
Which of the following is a condition caused by an infestation of head lice? A. Hepatitis B. Scabies C. Pediculosis capitis D. Tinea pedis
161/8-54/7 How would I set this problem up.
If 0.214 mol of argon gas occupies a volume of 343.4 mL at a particular temperature and pressure, what volume would 0.375 mol of argon gas occupy under the same
I think the message behind the central idea is...​
The radius of a circle is 8 meters. The diameter of the circle is . The formula for circumference is C = πd or C = 2πr. The circumference of the circle is appro
At some point, not close to its ends, within a solenoid of arbitrary length, calculate the approximate magnetic field if the solenoid carries a current 10.0 A a
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
In the world around you, if you wanted to create some instruments from items you have around the house or in your neighborhood, how would you make them? Describ
Please help!! I do not know the answers.. it’s due in 36 minutes!!