Leiladarkgale Leiladarkgale

04-02-2021
Physics

contestada

The wind during a tornado reaching 300 miles per hour

Speed
Velocity
Or acceleration

Respuesta :

christahjsmith christahjsmith

04-02-2021

Acceleration

Acceleration means to increase the speed or rate so if the wind during a tornado is reading 300 miles per hour then it’s accelerating.

Answer Link

Otras preguntas

The drawing shows the measurements in a section of a circular design how long is the radius of the circle? F. 4.3 G. 7 H. 8.7 J. 10

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

An element's atomic number is 64. How many protons would an atom of this element have?

what is the value of the expression i × i²× i³× i⁴

In a fruit punch, Sally mixed 3 3/4 cups of grape juice, 2 1/2 cups of pineapple juice and 6 2/3 of ginger ale. How many cups of punch did she have?

If f(x) = x2 – 25 and g(x) = x – 5, what is the domain of mc006-1.jpg?

If 5 potatoes together have a mass of 1 kg and 8 pears together have a mass of 1,200 grams, which has the greater mass, potato or pear? explain.

Can someone please help me with numbers 1, a, b, c, 2, a, b, c

Vince chooses 3 side dishes from a total of 10 side dishes offered on the menu is how many different ways can he choose

Concerns over the Spanish treatment of what nation help lead to the Spanish–American War? A. Hawaii B. Portugal C. Canada D. Cuba