d3thlkkr1
d3thlkkr1 d3thlkkr1
  • 02-11-2016
  • Mathematics
contestada

21.12 is 25.6% of what number?

Respuesta :

Telena
Telena Telena
  • 02-11-2016
5.40672 is your answer. Good luck!
Answer Link

Otras preguntas

HPD cord shall be permitted for a. hard usage b. not hard usage C. extra-hard usage d. all of these What’s the answer
A fair spinner has 10 equal sections: 3 red, 4 blue and 3 green. It is spun twice. What is the probability of getting the same colour twice? brainliest - asap
How do the voices of Albert in war horse and piete share the same and different thoughts fear and ideas
A customer buying a personal computer defines the types of disk drives, modem, memory configurations, and types of hardware when buying the product. Thus, the p
Ms. Baudino wants to challenge her AP Physics students to use high order thinking and problem solving skills while engaged in a meaningful, real-world learning
Type A is 10 feet tall and grows at a rate of 21 inches per year. Type B is 7 feet tall and grows at a rate of 25 inches per year. Algebraically determine ex
investigation, determine when the Elastic Potential Energy is zero. Make sure you test your idea with several masses, all three springs and vary the stiffness o
A digital certificate system Group of answer choices uses third-party CAs to validate a user's identity. uses digital signatures to validate a user's identity.
what multiplies to 1.25 and adds up to 3
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA