leahpatterson13 leahpatterson13

03-03-2021
Mathematics

contestada

Need help brainlest to whoever is right

Need help brainlest to whoever is right class=

Respuesta :

kyosomastantbh kyosomastantbh

03-03-2021

Answer:

2

Step-by-step explanation:

Answer Link

ShaniahPoweska ShaniahPoweska

03-03-2021

Answer:

x is equal to 2

Step-by-step explanation:

Just because

Answer Link

Otras preguntas

The available farmland in Mali is in the northeast. True or false

In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?

How did the Hellenistic kings spread Greek culture

Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2

On a number line, let point p represent the largest integer value that is less than 407. le point q represent the largest integer value that is less than 68 − .

Why did the United States go to war with Britain in 1812

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP ME !!!! Use I = PRT to solvEI = $350 P= $700 Find T (TIME IN YEARS) R= 10% (

Would someone please help me with my french? Thank you! Fill in the blank after reading the options and looking at the pictures. I will type out the options her

Compare and contrast the rise of franklin d. roosevelt in 1932 with the rise of adolf hitler in 1933.