anaiahred15 anaiahred15

03-05-2021
Mathematics

contestada

Find the area of the shaded region

A. 17 Square units
B. 32 Square units
C. 16 Square units
D. 36 Square units

Find the area of the shaded region A 17 Square units B 32 Square units C 16 Square units D 36 Square units class=

Respuesta :

03-05-2021

Answer:

16 square units

Step-by-step explanation:

→ Find the area of the whole triangle

0.5 × ( 5 + 4 ) × 8 = 36

→ Find the area of the small triangle

0.5 × 5 × 8 = 20

→ Minus the area's of the triangles

36 - 20 = 16 square units

Answer Link

Otras preguntas

Explain the carbon cycle and explain why burning fossil fuels is an issue.

Check the area that applies to a mesomorph body type. select one: a. trim waist b. trouble losing weight c. stoop-shouldered d. short heavy legs

How did the Bataan Death March gets its name

I=$310 P==$1,000 t=5 years

The culture of children strongly approves of children tattling on one and other. a. True b. False

The length of the shorter base in an isosceles trapezoid is 4 in, its altitude is 5 in, and the measure of one of its obtuse angles is 135°. Find the area of th

What is the value of x? x = 2 x = 3 x = 4 x = 6

What advice would you give someone whose life dream is to become a judge?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Definition: an event that is made up of two or more outcomes is called ____.