kaliabrintley kaliabrintley

02-06-2021
Mathematics

contestada

6. Mary worked 27 hours last week. If she gets paid $12/hour, what is her
gross pay?

Respuesta :

aldarwish aldarwish

02-06-2021

Answer:

324

Step-by-step explanation:

you would multiply 27 × 12 and that would equal 324

Answer Link

Otras preguntas

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used in one serving of soup?

what is 3/5 of 21? plz answer the question

Solve the equation by the method of your choice. StartFraction 1 Over x EndFraction plus StartFraction 1 Over x plus 4 EndFraction equals one half The solution

Sid is packing crushed ice into a cone-shaped cup. The cone has a height of 5 in. Its base has a diameter of 4 in. What is the volume of the cone?

Regents what was a goal of progressive era reforms such as recall, referendum, and the direct primary?

To what does the poet compare the lass? A. nomads B. musicians C. birds D. sailors

How have terrorism and the 9/11 attacks changed the policies of the United States in regards to immigrants and terrorism? Discuss the events of 9/11 and the War

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

20% of what number is equal to 2/3 of 90?