cliffordedwards5598 cliffordedwards5598

03-09-2021
Chemistry

contestada

Adenosine triphosphate (ATP) is the main energy currency used in cells.

a. True
b. False

Respuesta :

Lawliet55 Lawliet55

03-09-2021

Answer:

Verdadero

Explanation:

el ATP es una molécula orgánica que a porta energía a

Answer Link

Otras preguntas

PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single

When the term F.O.B. shipping point is used, title passes when the

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

the spread use of chop sticks into southeast asian countries with the influx of chinese migrants there is an example of which of the following concepts A. Stim

People and societies in which they live lie outside the biosphere.

A mutation that occurs in the gametes of an organism will most likely be transferred where

Solve the equation by the method of your choice. StartFraction 1 Over x EndFraction plus StartFraction 1 Over x plus 4 EndFraction equals one half The solution

. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm

PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .

Which of the following shows the graph of y=In(-2x)