aosera
aosera aosera
  • 01-01-2018
  • Mathematics
contestada

I do not understand how one got 7, 20, 39, 64, 95. Please explain.

I do not understand how one got 7 20 39 64 95 Please explain class=

Respuesta :

rekajenis17p296xr rekajenis17p296xr
  • 08-01-2018
n is 1,2,3,4,5
3n^2+4n we replace n with 1 and 3×1^2+4×1=7
we replace n now with 2 and 3×2^2+4×2=20 and so on
Answer Link

Otras preguntas

Please answer theses division problems!! 9 divided by 3/7
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
What is the sum of 6/10 plus 7/12
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why did the American public mostly oppose joining the League of Nations after WWI?
when Jefferson took office he did what
How many years does an apple tree live useful?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?