Arah7412
Arah7412 Arah7412
  • 03-01-2018
  • Chemistry
contestada

How can erosion form new land?

Respuesta :

Аноним Аноним
  • 03-01-2018
Water can take bit by bit of rock and land. Also ice can do this too.

Hope this helps!
Answer Link

Otras preguntas

The table below shows the total cost (TC) and marginal cost (MC) for Choco Lovers, a monopolistic firm producing different quantities of chocolate gift boxes. F
A farmer sells 9.6 kilograms of apples and pears at the farmer's market. 3/4 of this weight is apples, and the rest is pears. How many kilograms of pears did sh
Ifn is an odd integer that is less than -3.25, what is the greatest possible value of n?
The coordinates of point A are (6;4). The coordinates of point B are (3;4). Which expression represents the distance, in units, between points A and B?
The Sapir-Whorf hypothesis suggests that: a. language provides the category through which social reality is defined. b. reality is the result of social inequali
Which is closest to the value of w in the triangle below?
The frequency of data is the higest at
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
When​ materials, information, and services gain value as they move from the​ raw-materials supplier to the end​ customer, they are said to be moving through​ _
Which word used in place of the underline word would change the tone from angry to calm? Soon after, a man with a long overcoat hurried across the street. As th