maddy227 maddy227
  • 02-04-2018
  • Mathematics
contestada

How many lines of symmetry does a regular hexagon have?

Respuesta :

Аноним Аноним
  • 02-04-2018
Hexagon has 6 equal sides with 6 lines of symmetry.
Answer Link
kadenmelton kadenmelton
  • 05-06-2019

i think the answer s 6 bc i had the same question and i got it right s therefore the answer is 6 <3

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
Fossils are most commonly found in which type of rock?
why is it critical to your cells to be near capillaries
Please help solve, thanks in advance!
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Companies raise funds to expand their business by
Round 46.895 to the nearest tenth
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front